Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 117094285 117103135 enh47629
chr12 117100450 117100717 vista15048

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 117100172 rs112820863 C T 2930066
chr12 117100213 rs7977117 G A 2930067
chr12 117100413 rs58450056 C A 2930068
chr12 117100420 rs188850915 A G 2930069
chr12 117100429 rs75519650 C T 2930070
chr12 117100454 rs534269318 G C 2930071
chr12 117100516 rs75119764 C A 2930072
chr12 117100560 rs145681346 C G 2930073
chr12 117100672 rs34371970 G C,T 2930074
chr12 117100696 rs543880861 C G,T 2930075
chr12 117100704 rs564081863 G A 2930076
chr12 117100821 rs201515646 AG A 2930077
chr12 117100918 rs529561810 G C 2930078
chr12 117101005 rs143991428 A C 2930079
chr12 117101215 rs118013554 G A 2930080
chr12 117101374 rs11068132 A G 2930081
chr12 117101579 rs150731198 C T 2930082
chr12 117101598 rs563042065 C T 2930083
chr12 117101667 rs139431604 C G 2930084
chr12 117101713 rs190474789 C T 2930085
chr12 117101803 rs537636461 C T 2930086
chr12 117101994 rs145168688 C T 2930087
chr12 117102186 rs147170879 G A 2930088
chr12 117102442 rs140089107 C CTTTT 2930089
chr12 117102442 rs147465517 C CTTTT 2930090
chr12 117102465 rs530022454 T C 2930091
chr12 117102478 rs112576183 A G 2930092
chr12 117102479 rs2893687 G A 2930093
chr12 117102543 rs570244228 GATTTGGCAGTAAATGTAGGTAAATGCTGAACCACGACA G 2930094
chr12 117102625 rs112173468 C CTCTA 2930095
chr12 117102625 rs3069182 C CTCTA 2930096

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results