EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr12:120700858-120701182]
Chromosome characteristics of ZNF143[chr12:120700858-120701182]
Back to top
Enhancers possibly regulated by ZNF143[chr12:120700858-120701182]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 120686365 120701975 enh15043
Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-SH) Lung (PC-9) Esophagus Bone (Osteoblast) Lung Blood (GM12878) Stomach Muscle (A673) Placenta Thyroid Muscle (Myoblast) Pancreas Uterus Blood (T-cell) Heart
chr12 120700935 120701192 vista15119
VISTA
SNP sites on ZNF143[chr12:120700858-120701182]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 120700872 rs185296583 G A 2944973
chr12 120700926 rs188610942 G C 2944974
chr12 120700970 rs554328884 T TCCACCCTAAGGAAAACAGCTGAG 2944975
chr12 120701016 rs145771721 T C 2944976
chr12 120701050 rs191953264 C T 2944977
chr12 120701129 rs138690200 C T 2944978
Genes possibly regulated by ZNF143[chr12:120700858-120701182]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 120648250 120703574 - PXN ENSG00000089159.11 120703574 0.78 1.0 2392 12600
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF143[chr12:120700858-120701182]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results