Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 53382525 53394755 enh15618
chr14 53392802 53392977 vista17789

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 53392657 rs570884130 C G,T 3544599
chr14 53392669 rs118038754 G A,C 3544600
chr14 53392670 rs114246538 G A 3544601
chr14 53392698 rs12888271 G C 3544602
chr14 53392759 rs188007870 G A 3544603
chr14 53392867 rs59388902 A AAAAGGAAAATGGTTATCTAC 3544604
chr14 53392877 rs114217980 C T 3544605
chr14 53392973 rs114671381 T A 3544606

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results