EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr14:68942657-68943086]
Chromosome characteristics of ZBTB33[chr14:68942657-68943086]
Back to top
Enhancers possibly regulated by ZBTB33[chr14:68942657-68943086]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 68939545 68944315 enh62414
Prostate (PC-3) Epithelial (MCF-7) Esophagus Uterus Stomach
chr14 68943032 68943562 vista18229
VISTA
SNP sites on ZBTB33[chr14:68942657-68943086]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 68942709 rs138845273 G A 3625595
chr14 68942762 rs138305626 GAA G 3625596
chr14 68942762 rs765333919 GAA G 3625597
chr14 68942762 rs869045520 GAA G 3625598
chr14 68942873 rs73278387 C T 3625599
chr14 68943063 rs552296312 G GAATGCTGATTAGTTCCATCACT 3625600
Genes possibly regulated by ZBTB33[chr14:68942657-68943086]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr14:68942657-68943086]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results