Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 68939545 68944315 enh62414
chr14 68943032 68943562 vista18229

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 68943063 rs552296312 G GAATGCTGATTAGTTCCATCACT 3625600
chr14 68943137 rs142031268 G A 3625601
chr14 68943161 rs28376370 C T 3625602
chr14 68943381 rs541422345 CAG C 3625603
chr14 68943414 rs61257313 A C 3625604
chr14 68943422 rs146346614 G A,C 3625605
chr14 68943496 rs572213126 A G,T 3625606
chr14 68943512 rs189486090 T A 3625607
chr14 68943533 rs180846493 G T 3625608
chr14 68943643 rs578126110 GC G 3625609

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results