EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr14:92995477-92996243]
Chromosome characteristics of ZNF143[chr14:92995477-92996243]
Back to top
Enhancers possibly regulated by ZNF143[chr14:92995477-92996243]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 92992145 93022095 enh15873
Brain (SK-N-MC) Astrocyte Uterus Blood (T-cell) Stomach Bone (Osteoblast) Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Breast Spleen Liver (HepG2) Lung Heart
chr14 92996224 92996503 vista18854
VISTA
SNP sites on ZNF143[chr14:92995477-92996243]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 92995543 rs542411964 A G 3736167
chr14 92995614 rs188664487 A G 3736168
chr14 92995651 rs55703805 G C 3736169
chr14 92995656 rs572863608 GATCTCGGCTCACTGCAACCTCCACCTCCCC G 3736170
chr14 92995661 rs141479077 C T 3736171
chr14 92995736 rs114031777 G A 3736172
chr14 92995749 rs61354681 C T 3736173
chr14 92995754 rs191765497 G A,C 3736174
chr14 92995882 rs144053354 G A 3736175
chr14 92995987 rs12893972 G A 3736176
chr14 92996101 rs60298786 A C 3736177
chr14 92996108 rs55917551 G A 3736178
chr14 92996172 rs547404665 A G 3736179
chr14 92996181 rs8019318 G A 3736180
chr14 92996203 rs113108332 G T 3736181
Genes possibly regulated by ZNF143[chr14:92995477-92996243]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr14:92995477-92996243]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results