Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 94357365 94363615 enh62432
chr14 94360342 94360641 vista18900

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 94360579 rs55805429 C A 3745005
chr14 94360592 rs78010124 G A 3745006
chr14 94360633 rs147509755 ACGCTCTCGTGTCCCCTTCCTTC A 3745007
chr14 94360633 rs375669140 ACGCTCTCGTGTCCCCTTCCTTC A 3745008
chr14 94360712 rs77227924 A G 3745009
chr14 94360774 rs77158062 C G 3745010
chr14 94360790 rs34426188 C T 3745011
chr14 94361020 rs35314337 A C,G 3745012
chr14 94361052 rs528092929 A C 3745013
chr14 94361057 rs150977647 C T 3745014
chr14 94361100 rs12885628 G T 3745015
chr14 94361196 rs73337784 C T 3745016
chr14 94361328 rs72698217 G A 3745017
chr14 94361379 rs140846788 C T 3745018

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results