EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr14:105434596-105435207]
Chromosome characteristics of ZNF274[chr14:105434596-105435207]
Back to top
Enhancers possibly regulated by ZNF274[chr14:105434596-105435207]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 105430265 105443481 enh15985
Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Brain (SK-N-SH) Large Intestine Ovary Esophagus Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Placenta Thyroid Pancreas Pancreas (Panc1) Muscle (Myotube) Uterus Heart
chr14 105434660 105434907 vista19259
VISTA
chr14 105435117 105435479 vista19260
VISTA
SNP sites on ZNF274[chr14:105434596-105435207]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 105434615 rs112312376 G A 3826919
chr14 105434646 rs139284487 TGCCTCCCCGAGAACTGGACTATCCTG T 3826920
chr14 105434646 rs376491872 TGCCTCCCCGAGAACTGGACTATCCTG T 3826921
chr14 105434779 rs28583515 C T 3826922
chr14 105434784 rs117034252 A T 3826923
chr14 105434893 rs202094850 T TG 3826924
chr14 105434896 rs76901420 G A,C 3826925
chr14 105435027 rs568908303 C A,T 3826926
chr14 105435034 rs554277774 G A 3826927
chr14 105435086 rs574339650 C T 3826928
Genes possibly regulated by ZNF274[chr14:105434596-105435207]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr14:105434596-105435207]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results