EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr15:39627408-39627731]
Chromosome characteristics of ZNF274[chr15:39627408-39627731]
Back to top
Enhancers possibly regulated by ZNF274[chr15:39627408-39627731]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 39621746 39629695 enh62454
Esophagus Prostate (PC-3) Uterus Prostate (RWPE1)
chr15 39627132 39627473 vista19669
VISTA
SNP sites on ZNF274[chr15:39627408-39627731]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 39627413 rs138739597 CCACCACTCTTCCTCATGGCCCCT C 3905075
chr15 39627413 rs377611952 CCACCACTCTTCCTCATGGCCCCT C 3905076
chr15 39627438 rs190454780 A C 3905077
chr15 39627455 rs115435342 G A 3905078
chr15 39627500 rs77466909 T A,C 3905079
chr15 39627537 rs113351434 A G,T 3905080
chr15 39627549 rs545003391 G A 3905081
chr15 39627592 rs112230806 C A 3905082
Genes possibly regulated by ZNF274[chr15:39627408-39627731]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr15:39627408-39627731]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results