Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 57614255 rs141902977 GTCAC G 3977491
chr15 57614265 rs550122754 C T 3977492
chr15 57614271 rs74425960 A C,G 3977493
chr15 57614310 rs150785927 AGCTTGGGTCCCTTCCAGCAATGAT A 3977494
chr15 57614310 rs532110771 A G 3977495
chr15 57614310 rs59696901 AGCTTGGGTCCCTTCCAGCAATGAT A 3977496
chr15 57614482 rs142297815 C T 3977497
chr15 57614545 rs11631073 C T 3977498
chr15 57614667 rs188532857 C G 3977499
chr15 57614691 rs575746629 G T 3977500

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results