EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr15:59847846-59848349]
Chromosome characteristics of ZNF274[chr15:59847846-59848349]
Back to top
Enhancers possibly regulated by ZNF274[chr15:59847846-59848349]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 59839149 59852035 enh44125
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Large Intestine Colon (HCT116) Lung (PC-9) Muscle (Myotube) Neural Stem Cells (H9) Stomach
chr15 59848106 59848258 vista20166
VISTA
SNP sites on ZNF274[chr15:59847846-59848349]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 59847848 rs56305024 C T 3994629
chr15 59847944 rs184312977 C T 3994630
chr15 59847947 rs115307982 G A 3994631
chr15 59847976 rs188293531 T C 3994632
chr15 59847998 rs569792105 CAATCCCAGCTATTCGGTGGCTGAGGCACAAG C 3994633
chr15 59848242 rs12914046 T A,C 3994634
chr15 59848252 rs7176379 C T 3994635
chr15 59848259 rs181511313 G A 3994636
chr15 59848315 rs151135984 T A 3994637
chr15 59848339 rs55650268 A C 3994638
Genes possibly regulated by ZNF274[chr15:59847846-59848349]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr15:59847846-59848349]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results