EnhancerDB
  1. Home
  2. TFBS
  3. POLR2A[chr16:29137278-29137584]
Chromosome characteristics of POLR2A[chr16:29137278-29137584]
Back to top
Enhancers possibly regulated by POLR2A[chr16:29137278-29137584]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 29137405 29145023 enh16622
Esophagus Placenta Uterus Heart
chr16 29137517 29137756 vista22317
VISTA
SNP sites on POLR2A[chr16:29137278-29137584]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 29137287 rs191619455 A G 4401629
chr16 29137377 rs1642008 C T 4401630
chr16 29137435 rs553469675 TGGTGTTAGAGACCAGGATGC T 4401631
chr16 29137455 rs76655108 C T 4401632
chr16 29137508 rs117417282 C A,T 4401633
chr16 29137512 rs547263992 G A 4401634
Genes possibly regulated by POLR2A[chr16:29137278-29137584]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POLR2A[chr16:29137278-29137584]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results