EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr17:2167361-2167666]
Chromosome characteristics of ZZZ3[chr17:2167361-2167666]
Back to top
Enhancers possibly regulated by ZZZ3[chr17:2167361-2167666]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 2160245 2169115 enh32051
Skin (Keratinocyte) Prostate (PC-3) Blood (T-cell) Esophagus Astrocyte Bone (Osteoblast) Blood (GM12878) Peripheral Blood (MM.1S) Muscle (Myoblast) Muscle (Myotube) Uterus Thymus
chr17 2167377 2167408 vista23708
VISTA
SNP sites on ZZZ3[chr17:2167361-2167666]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 2167368 rs141256540 GCTCCCAGAGTAACATCACCTCACTA G 4700835
chr17 2167370 rs539706347 T C 4700836
chr17 2167393 rs576185956 A G 4700837
chr17 2167404 rs535334226 T C 4700838
chr17 2167515 rs74876703 G A 4700839
Genes possibly regulated by ZZZ3[chr17:2167361-2167666]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr17:2167361-2167666]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results