Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 27537765 27549799 enh58745
chr17 27539560 27540084 vista24333

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 27539288 rs572053739 C T 4815647
chr17 27539372 rs146222683 A G 4815648
chr17 27539383 rs78734389 C T 4815649
chr17 27539457 rs140290278 ATT A 4815650
chr17 27539514 rs562869278 A G 4815651
chr17 27539652 rs139184974 T C 4815652
chr17 27539701 rs115847901 C T 4815653
chr17 27539764 rs373219496 G GCTGATTAGTATCATTGTGTCATCCA 4815654
chr17 27539764 rs550043951 G GCTGATTAGTATCATTGTGTCATCCA 4815655

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results