EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:39652728-39653388]
Chromosome characteristics of ZNF274[chr17:39652728-39653388]
Back to top
Enhancers possibly regulated by ZNF274[chr17:39652728-39653388]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 39651125 39655275 enh81209
Prostate (PC-3)
chr17 39653134 39653351 vista24772
VISTA
SNP sites on ZNF274[chr17:39652728-39653388]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 39652862 rs529201301 G A 4872883
chr17 39652937 rs139386502 A T 4872884
chr17 39653065 rs551499622 G A,C 4872885
chr17 39653065 rs576305077 G GGCCAGGACTGGGTCTAGGGCCCA 4872886
chr17 39653121 rs115573575 T C 4872887
chr17 39653122 rs7222980 T C 4872888
chr17 39653212 rs57333321 C T 4872889
chr17 39653215 rs73983500 T C 4872890
chr17 39653359 rs572239640 C A 4872891
Genes possibly regulated by ZNF274[chr17:39652728-39653388]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:39652728-39653388]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results