EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr17:40669882-40670538]
Chromosome characteristics of ZBTB33[chr17:40669882-40670538]
Back to top
Enhancers possibly regulated by ZBTB33[chr17:40669882-40670538]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 40666365 40672295 enh17163
Bone Marrow (K562) Skin (Keratinocyte) Cervix (HeLa-S3) Brain (SK-N-SH) Brain (SK-N-MC) Large Intestine Ovary Esophagus Bone (Osteoblast) Muscle (A673) Placenta Lung (PC-9) Pancreas Uterus Thymus Kidney
chr17 40670495 40670831 vista24823
VISTA
SNP sites on ZBTB33[chr17:40669882-40670538]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 40669950 rs375049540 T C 4879173
chr17 40670142 rs144442461 G A 4879174
chr17 40670175 rs4479304 C T 4879175
chr17 40670230 rs3785897 C G 4879176
chr17 40670242 rs141112514 C T 4879177
chr17 40670287 rs539667295 GATTGGGTGGTGATTAAAGGGACAGA G 4879178
chr17 40670297 rs191056649 T C 4879179
Genes possibly regulated by ZBTB33[chr17:40669882-40670538]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr17:40669882-40670538]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results