EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr17:48877886-48879755]
Chromosome characteristics of ZNF143[chr17:48877886-48879755]
Back to top
Enhancers possibly regulated by ZNF143[chr17:48877886-48879755]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 48854945 48879175 enh17223
Skin (Keratinocyte) Prostate (RWPE1) Blood (T-cell) Esophagus Stomach Muscle (A673) Placenta Thyroid Pancreas Spleen Thymus Heart
chr17 48877863 48877967 vista25123
VISTA
SNP sites on ZNF143[chr17:48877886-48879755]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 48877899 rs16949303 G A,C 4925652
chr17 48878150 rs118003540 C A 4925653
chr17 48878156 rs144643080 G A 4925654
chr17 48878164 rs138599943 G T 4925655
chr17 48878173 rs111396971 G A 4925656
chr17 48878174 rs11652675 G T 4925657
chr17 48878177 rs557773835 AG A 4925658
chr17 48878288 rs140318757 G A 4925659
chr17 48878299 rs113324957 C T 4925660
chr17 48878300 rs114533217 G A 4925661
chr17 48878309 rs112354603 G A 4925662
chr17 48878312 rs141781294 C T 4925663
chr17 48878335 rs150597863 T C 4925664
chr17 48878371 rs143018606 C T 4925665
chr17 48878404 rs200914980 AGAG A 4925666
chr17 48878443 rs78588087 G A 4925667
chr17 48878475 rs115997920 C G 4925668
chr17 48878526 rs557414215 C A 4925669
chr17 48878639 rs2898948 G A 4925670
chr17 48878685 rs4793672 T C 4925671
chr17 48878781 rs116069869 A G 4925672
chr17 48878848 rs4793673 A G 4925673
chr17 48878943 rs534691087 GGTGGCTGGATCATTCATGGAGAGA G 4925674
chr17 48879061 rs147472805 G A 4925675
chr17 48879108 rs757610 T A,C 4925676
chr17 48879203 rs117755098 C G 4925677
chr17 48879311 rs139983446 T C 4925678
chr17 48879366 rs573473786 G A,C 4925679
chr17 48879449 rs574954776 T A 4925680
chr17 48879523 rs79853469 G A 4925681
chr17 48879702 rs144334417 A G 4925682
chr17 48879707 rs148780142 G A,T 4925683
chr17 48879718 rs79048109 G T 4925684
Genes possibly regulated by ZNF143[chr17:48877886-48879755]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr17:48877886-48879755]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results