EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr17:79023179-79024997]
Chromosome characteristics of ZBTB33[chr17:79023179-79024997]
Back to top
Enhancers possibly regulated by ZBTB33[chr17:79023179-79024997]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 79008825 79027145 enh17433
Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Lung Muscle (A673) Heart
chr17 79024187 79024380 vista26372
VISTA
SNP sites on ZBTB33[chr17:79023179-79024997]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 79023185 rs149335094 C T 5109242
chr17 79023212 rs114196123 G A 5109243
chr17 79023265 rs546792411 G T 5109244
chr17 79023336 rs571566474 T C 5109245
chr17 79023380 rs6565531 G A 5109246
chr17 79023453 rs6565532 C T 5109247
chr17 79023505 rs553214210 T C 5109248
chr17 79023525 rs572149523 C G 5109249
chr17 79023531 rs148410800 G C 5109250
chr17 79023556 rs530567341 G T 5109251
chr17 79023601 rs117813056 G A 5109252
chr17 79023844 rs183059981 C A 5109253
chr17 79023847 rs4073257 G A 5109254
chr17 79023856 rs56933243 C T 5109255
chr17 79023953 rs58337218 C T 5109256
chr17 79023975 rs557338822 A G 5109257
chr17 79023990 rs114227601 C G,T 5109258
chr17 79024002 rs116232474 C T 5109259
chr17 79024003 rs145959845 G A 5109260
chr17 79024024 rs139878830 C G 5109261
chr17 79024027 rs74451988 T C 5109262
chr17 79024076 rs4969365 A G 5109263
chr17 79024157 rs544212403 C CCTGCCCGCTGT,CCTGCCCGCTGTCTGCCCGCTGT 5109264
chr17 79024163 rs55745320 C T 5109265
chr17 79024167 rs35425500 G C 5109266
chr17 79024185 rs372506615 G A 5109267
chr17 79024274 rs375170535 G A 5109268
chr17 79024284 rs554525747 C T 5109269
chr17 79024364 rs560713752 C T 5109270
chr17 79024365 rs8066732 G A 5109271
chr17 79024475 rs146608989 A G 5109272
chr17 79024518 rs112145291 C T 5109273
chr17 79024546 rs555493601 GAC G 5109274
chr17 79024591 rs560524100 A G 5109275
chr17 79024637 rs8067235 G A 5109276
chr17 79024649 rs550722937 T G 5109277
chr17 79024697 rs116021696 C T 5109278
chr17 79024834 rs576497955 C T 5109279
chr17 79024865 rs113904948 C G 5109280
chr17 79024869 rs149863889 C T 5109281
chr17 79024915 rs8069327 A C 5109282
chr17 79024927 rs186614345 C T 5109283
chr17 79024930 rs147402717 CT C 5109284
Genes possibly regulated by ZBTB33[chr17:79023179-79024997]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr17:79023179-79024997]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results