EnhancerDB
  1. Home
  2. TFBS
  3. SOX2[chr17:79023833-79024223]
Chromosome characteristics of SOX2[chr17:79023833-79024223]
Back to top
Enhancers possibly regulated by SOX2[chr17:79023833-79024223]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 79008825 79027145 enh17433
Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Lung Muscle (A673) Heart
chr17 79024187 79024380 vista26372
VISTA
SNP sites on SOX2[chr17:79023833-79024223]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 79023844 rs183059981 C A 5109253
chr17 79023847 rs4073257 G A 5109254
chr17 79023856 rs56933243 C T 5109255
chr17 79023953 rs58337218 C T 5109256
chr17 79023975 rs557338822 A G 5109257
chr17 79023990 rs114227601 C G,T 5109258
chr17 79024002 rs116232474 C T 5109259
chr17 79024003 rs145959845 G A 5109260
chr17 79024024 rs139878830 C G 5109261
chr17 79024027 rs74451988 T C 5109262
chr17 79024076 rs4969365 A G 5109263
chr17 79024157 rs544212403 C CCTGCCCGCTGT,CCTGCCCGCTGTCTGCCCGCTGT 5109264
chr17 79024163 rs55745320 C T 5109265
chr17 79024167 rs35425500 G C 5109266
chr17 79024185 rs372506615 G A 5109267
Genes possibly regulated by SOX2[chr17:79023833-79024223]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SOX2[chr17:79023833-79024223]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results