Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 79064585 rs145245664 G GGCTGCCTGGCTGGGATGT 5109952
chr17 79064626 rs373377032 G C 5109953
chr17 79064641 rs548835242 C A 5109954
chr17 79064645 rs11655132 G A 5109955
chr17 79064722 rs577710007 G A 5109956
chr17 79064730 rs141388692 C T 5109957
chr17 79064844 rs538392577 CCCCGCCCCCACTTGTGTGGA C 5109958
chr17 79064851 rs575884626 C A 5109959

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results