EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:2167010-2170359]
Chromosome characteristics of ZNF274[chr19:2167010-2170359]
Back to top
Enhancers possibly regulated by ZNF274[chr19:2167010-2170359]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 2165405 2178635 enh32873
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Large Intestine Esophagus Astrocyte Liver Bone (Osteoblast) Stomach Muscle (A673) Colon (HCT116) Thyroid Pancreas Blood (T-cell) Heart
chr19 2167436 2167667 vista28203
VISTA
chr19 2168320 2168637 vista28204
VISTA
chr19 2168890 2169464 vista28205
VISTA
SNP sites on ZNF274[chr19:2167010-2170359]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 2167022 rs115147517 A G 5381878
chr19 2167026 rs72985410 T G 5381879
chr19 2167074 rs149181056 A C 5381880
chr19 2167166 rs193284911 G A 5381881
chr19 2167209 rs116727017 G T 5381882
chr19 2167212 rs117946421 G T 5381883
chr19 2167303 rs114516972 C A,T 5381884
chr19 2167316 rs572071896 G A 5381885
chr19 2167436 rs76039528 G A 5381886
chr19 2167466 rs117459786 C A,T 5381887
chr19 2167559 rs117288331 C T 5381888
chr19 2167738 rs12981656 T C 5381889
chr19 2167773 rs191299464 C T 5381890
chr19 2167822 rs143343585 C A 5381891
chr19 2167860 rs563247152 C A 5381892
chr19 2167878 rs4807205 A G 5381893
chr19 2167940 rs539768963 G A,C 5381894
chr19 2168020 rs142033294 C T 5381895
chr19 2168023 rs146343891 C A,T 5381896
chr19 2168033 rs115935456 C T 5381897
chr19 2168097 rs188711185 G A 5381898
chr19 2168135 rs549045895 C T 5381899
chr19 2168145 rs79473699 C G,T 5381900
chr19 2168160 rs138195816 T C 5381901
chr19 2168199 rs570063357 G T 5381902
chr19 2168204 rs4807206 T A 5381903
chr19 2168366 rs142788047 C G 5381904
chr19 2168411 rs545190736 C T 5381905
chr19 2168500 rs146017256 T G 5381906
chr19 2168509 rs77769171 C G,T 5381907
chr19 2168515 rs58059306 G A 5381908
chr19 2168540 rs78069541 G C 5381909
chr19 2168611 rs185397213 C T 5381910
chr19 2168612 rs12983458 A G 5381911
chr19 2168642 rs112820392 C T 5381912
chr19 2168694 rs7249786 A G 5381913
chr19 2168821 rs144542675 G A 5381914
chr19 2168834 rs7249577 C T 5381915
chr19 2168903 rs572708207 G A 5381916
chr19 2168912 rs533966656 C G 5381917
chr19 2168917 rs12459731 G A 5381918
chr19 2168994 rs78892835 G A,T 5381919
chr19 2169067 rs7251881 G A 5381920
chr19 2169121 rs7256735 T C,G 5381921
chr19 2169133 rs143857041 C CA 5381922
chr19 2169163 rs114804531 C T 5381923
chr19 2169165 rs557509999 G A 5381924
chr19 2169180 rs116965803 G A 5381925
chr19 2169201 rs554518847 G A 5381926
chr19 2169224 rs56278961 C T 5381927
chr19 2169322 rs141927301 G A 5381928
chr19 2169527 rs546652954 C G 5381929
chr19 2169617 rs11084927 C G,T 5381930
chr19 2169624 rs536443466 C T 5381931
chr19 2169905 rs565586817 C T 5381932
chr19 2169938 rs551039923 C T 5381933
chr19 2169941 rs182609541 C T 5381934
chr19 2169972 rs57256605 A G 5381935
chr19 2170058 rs570462029 G A 5381936
chr19 2170062 rs574098670 G A,C,T 5381937
chr19 2170110 rs4807207 T G 5381938
chr19 2170183 rs553600673 A G 5381939
chr19 2170205 rs4807208 A C 5381940
chr19 2170291 rs538594173 TGCCCCTGGTGTGGTTGGGAG T 5381941
chr19 2170304 rs75397174 G A 5381942
chr19 2170314 rs117473937 G A 5381943
chr19 2170350 rs114496158 A C 5381944
Genes possibly regulated by ZNF274[chr19:2167010-2170359]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr19:2167010-2170359]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results