EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:4969968-4970765]
Chromosome characteristics of ZNF274[chr19:4969968-4970765]
Back to top
Enhancers possibly regulated by ZNF274[chr19:4969968-4970765]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 4966316 4995955 enh4974
Liver Astrocyte Colon (HCT116) Adrenal Blood (Karpas-422) Pancreas Uterus Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Thyroid Thymus Prostate (PC-3) Cervix (HeLa-S3) Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr19 4970760 4971027 vista28372
VISTA
SNP sites on ZNF274[chr19:4969968-4970765]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 4970048 rs11879865 G A 5405018
chr19 4970098 rs539463878 A G 5405019
chr19 4970108 rs555875788 C A 5405020
chr19 4970368 rs578186270 C G 5405021
chr19 4970458 rs73536536 C T 5405022
chr19 4970465 rs141383674 G C 5405023
chr19 4970474 rs72988139 A G 5405024
chr19 4970593 rs12609484 G T 5405025
chr19 4970723 rs528694087 ACGGGGTCAGCCTTCTCCTGCAGCCCCTGCTGAAG A 5405026
Genes possibly regulated by ZNF274[chr19:4969968-4970765]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 4969125 5153606 + KDM4B ENSG00000127663.10 4969125 0.71 1.0 843 16856
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr19:4969968-4970765]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results