Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 216515065 216536375 enh34238
chr2 216522690 216522921 vista34638

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 216522675 rs62180904 C T 6347384
chr2 216522759 rs140254731 CTCTTGCCTACCTAACATGG C 6347385
chr2 216522759 rs367762555 CTCTTGCCTACCTAACATGG C 6347386
chr2 216522886 rs16854640 A T 6347387

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results