EnhancerDB
  1. Home
  2. TFBS
  3. POLR2A[chr3:124604852-124606766]
Chromosome characteristics of POLR2A[chr3:124604852-124606766]
Back to top
Enhancers possibly regulated by POLR2A[chr3:124604852-124606766]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 124592410 124605215 enh20882
Prostate (PC-3) Liver (HepG2) Brain (SK-N-MC) Astrocyte Bone (Osteoblast) Muscle (A673) Placenta Lung (PC-9) Neural Stem Cells (H9) Heart
chr3 124605050 124605342 vista42255
VISTA
SNP sites on POLR2A[chr3:124604852-124606766]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 124604858 rs1007856 A G 7000168
chr3 124604899 rs187522072 A G 7000169
chr3 124604910 rs564242879 T C 7000170
chr3 124604921 rs552473842 C A,T 7000171
chr3 124605044 rs193297869 G A 7000172
chr3 124605069 rs184666197 G A 7000173
chr3 124605070 rs188972865 C A 7000174
chr3 124605143 rs550006860 G A 7000175
chr3 124605223 rs577608856 G A 7000176
chr3 124605306 rs181372104 G A 7000177
chr3 124605531 rs6438860 C G 7000178
chr3 124605596 rs551883371 GGCGGGGCTGCGCGCGGGGAGCGCCCC G 7000179
chr3 124605718 rs542370871 C T 7000180
chr3 124605736 rs6438861 T C 7000181
chr3 124605943 rs61760564 G A,T 7000182
chr3 124605966 rs564502016 C T 7000183
chr3 124605981 rs569145738 GCGCCCGCGCTGGCCCGCGCCCCGC G 7000184
chr3 124606082 rs550043605 A G 7000185
chr3 124606084 rs569940924 T A 7000186
chr3 124606238 rs559665973 C A 7000187
chr3 124606301 rs549128377 C A 7000188
chr3 124606339 rs150105132 T C 7000189
chr3 124606474 rs61760563 G A 7000190
chr3 124606478 rs375497711 A C,G 7000191
chr3 124606509 rs61760562 G A 7000192
chr3 124606536 rs145504156 T C 7000193
chr3 124606586 rs563652168 G A 7000194
chr3 124606620 rs373679199 G A 7000195
chr3 124606702 rs189983633 G C 7000196
chr3 124606719 rs181203090 G A 7000197
chr3 124606753 rs4679113 T A 7000198
Genes possibly regulated by POLR2A[chr3:124604852-124606766]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POLR2A[chr3:124604852-124606766]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results