Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 125975545 125994175 enh20889
chr3 125986265 125986571 vista42283

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 125986200 rs530452715 CGGCTCAGGGATCCCAGGCTGT C 7007662
chr3 125986248 rs111358401 T A 7007663

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results