EnhancerDB
  1. Home
  2. TFBS
  3. GATA2[chr3:126854215-126854481]
Chromosome characteristics of GATA2[chr3:126854215-126854481]
Back to top
Enhancers possibly regulated by GATA2[chr3:126854215-126854481]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 126850860 126863037 enh54338
Brain (SK-N-SH) Prostate (RWPE1) Large Intestine Stomach Embryonic Stem Cell Line (H1-hESC) Pancreas Heart
chr3 126854229 126854593 vista42307
VISTA
SNP sites on GATA2[chr3:126854215-126854481]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 126854220 rs532065242 G C 7011963
chr3 126854335 rs182302178 C T 7011964
chr3 126854344 rs77251534 C G 7011965
chr3 126854382 rs142861110 G T 7011966
chr3 126854436 rs562275414 A ACGGTCGCAGTCCCGACTGACACG,ATGGTCGCCGTCC 7011967
chr3 126854439 rs142595629 G GCTGACACGCGC,GTCGCCGTCCCGGCTGACACGCGC 7011968
Genes possibly regulated by GATA2[chr3:126854215-126854481]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by GATA2[chr3:126854215-126854481]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results