Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 88784505 88791922 enh36793
chr4 88787227 88787597 vista45353

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 88787247 rs567949821 ACTTCCCCAGGAGGCCTCCCACACAATTT A 7673335
chr4 88787249 rs4693189 T C 7673336
chr4 88787350 rs13107310 G T 7673337
chr4 88787368 rs117645650 C G,T 7673338
chr4 88787439 rs6821260 T C 7673339
chr4 88787499 rs28758373 A G 7673340
chr4 88787535 rs13107383 C A 7673341
chr4 88787553 rs147878550 G C 7673342
chr4 88787560 rs117676857 A G 7673343
chr4 88787606 rs145508351 CT C 7673344
chr4 88787615 rs142998954 T TC 7673345
chr4 88787615 rs879480161 T TC,TCC 7673346
chr4 88787620 rs116067743 C A,G,T 7673347

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results