EnhancerDB
  1. Home
  2. TFBS
  3. EBF1[chr6:32986672-32986988]
Chromosome characteristics of EBF1[chr6:32986672-32986988]
Back to top
Enhancers possibly regulated by EBF1[chr6:32986672-32986988]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 32983845 32989555 enh9053
Large Intestine Blood (T-cell) Blood (GM12878) Stomach Placenta Blood (Karpas-422) Pancreas Uterus Thymus Heart
chr6 32986611 32987175 vista51624
VISTA
SNP sites on EBF1[chr6:32986672-32986988]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 32986677 rs6906636 G T 8970550
chr6 32986737 rs559930167 T C 8970551
chr6 32986749 rs419434 G A 8970552
chr6 32986782 rs3130606 G A,T 8970553
chr6 32986822 rs6906405 A C 8970554
chr6 32986835 rs435119 G C 8970555
chr6 32986895 rs183670337 G A,T 8970556
chr6 32986905 rs112089450 CTTTCACTTTCCCGTCTCATGCAAAG C 8970557
chr6 32986957 rs6933782 T C 8970558
chr6 32986982 rs71565363 A G 8970559
chr6 32986986 rs6933796 T C 8970560
Genes possibly regulated by EBF1[chr6:32986672-32986988]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by EBF1[chr6:32986672-32986988]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results