EnhancerDB
  1. Home
  2. TFBS
  3. MAX[chr7:1501236-1501592]
Chromosome characteristics of MAX[chr7:1501236-1501592]
Back to top
Enhancers possibly regulated by MAX[chr7:1501236-1501592]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 1501465 1508655 enh23919
Cervix (HeLa-S3) Large Intestine Astrocyte Stomach Muscle (A673) Placenta Peripheral Blood (MM.1S) Uterus Heart
chr7 1501148 1501314 vista54787
VISTA
SNP sites on MAX[chr7:1501236-1501592]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 1501262 rs113583990 G A 9572969
chr7 1501273 rs149077526 G C 9572970
chr7 1501398 rs533546795 G C 9572971
chr7 1501580 rs148102179 G A 9572972
chr7 1501583 rs560908177 GTAAATGCAGCATGATGTACCCACCCAGGCACGCAA G 9572973
chr7 1501590 rs556487018 CA C 9572974
Genes possibly regulated by MAX[chr7:1501236-1501592]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MAX[chr7:1501236-1501592]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results