EnhancerDB
  1. Home
  2. TFBS
  3. CTCF[chr7:1546514-1546943]
Chromosome characteristics of CTCF[chr7:1546514-1546943]
Back to top
Enhancers possibly regulated by CTCF[chr7:1546514-1546943]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 1546890 1565055 enh23920
Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Blood (T-cell) Bone (Osteoblast) Blood (OCI-LY7) Stomach Muscle (A673) Placenta Colon (HCT116) Lung (PC-9) Pancreas (Panc1) Uterus Thymus Heart
chr7 1546424 1546775 vista54789
VISTA
SNP sites on CTCF[chr7:1546514-1546943]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 1546578 rs113995120 G C 9573116
chr7 1546636 rs146912250 TGTTGACATTCACACGTACCTGTG T 9573117
chr7 1546642 rs182314283 C T 9573118
chr7 1546692 rs115169726 G A,C 9573119
chr7 1546808 rs369579900 G A 9573120
chr7 1546839 rs111819550 CT C 9573121
chr7 1546896 rs186581297 G A 9573122
Genes possibly regulated by CTCF[chr7:1546514-1546943]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by CTCF[chr7:1546514-1546943]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results