Chrom Start End Enhancer ID Tissues that enhancer appears More
chr18 77325165 77332955 enh32863

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 77326251 rs116252613 C T 5358931
chr18 77326251 rs557784974 C CTGTTCCTTTGAGGTGAGGGTCCCGGGTCGTGTGCACGCCTGCCTTCT 5358932

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results