Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 68296501 rs556601948 GCAGGAAGATCGCTTGAAAC G 4499715

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 68298433 68335722 + SLC7A6 ENSG00000103064.9 68298433 0.9 0.99 1923 14987


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results