Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 858228 870935 enh86290

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 867678 rs370817085 C T 5368686
chr19 867684 rs562620638 AACAAGGAGAGCACGCAGAG A 5368687
chr19 867697 rs180680089 C T 5368688
chr19 867698 rs138392000 G A,T 5368689

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results