EnhancerDB
  1. Home
  2. TFBS
  3. REST[chr19:867678-867697]
Chromosome characteristics of REST[chr19:867678-867697]
Back to top
Enhancers possibly regulated by REST[chr19:867678-867697]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 858228 870935 enh86290
Colon (HCT116) Uterus Stomach
SNP sites on REST[chr19:867678-867697]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 867678 rs370817085 C T 5368686
chr19 867684 rs562620638 AACAAGGAGAGCACGCAGAG A 5368687
chr19 867697 rs180680089 C T 5368688
Genes possibly regulated by REST[chr19:867678-867697]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by REST[chr19:867678-867697]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results