EnhancerDB
  1. Home
  2. TFBS
  3. SP1[chr19:945397-945407]
Chromosome characteristics of SP1[chr19:945397-945407]
Back to top
Enhancers possibly regulated by SP1[chr19:945397-945407]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 927725 963215 enh4948
Bone Marrow (K562) Liver (HepG2) Cervix (HeLa-S3) Epithelial (MCF-7) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Astrocyte Bone (Osteoblast) Lung Blood (GM12878) Stomach Placenta Colon (HCT116) Thyroid Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Heart
SNP sites on SP1[chr19:945397-945407]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 945397 rs532146941 ACCCAGCCCACCTCCGTCTGCTCCCTAGCGGGGAGGTGTCCAGGGCGGC A 5369868
Genes possibly regulated by SP1[chr19:945397-945407]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SP1[chr19:945397-945407]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results