Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1174025 1184042 enh17839

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1180838 rs137858143 GTCTGTCTCTGTCTCTGTCTCTA G 5372896
chr19 1180838 rs375998161 GTCTGTCTCTGTCTCTGTCTCTA G 5372897

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results