Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 3170105 3178875 enh17860

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 3176802 rs555374358 C CCAGACCCCAGGGCAAGGCTGAGCCTCCCTCCT 5392198
chr19 3176802 rs60942980 C CCAGACCCCAGGGCAAGGCTGAGCCTCCCTCCT 5392199

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results