Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 5272745 5283955 enh4979

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 5283269 rs61590743 AACCCCAGCACTTTCTCCTGTC A 5408202
chr19 5283269 rs72394087 AACCCCAGCACTTTCTCCTGTC A 5408203

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results