Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 10918125 10930655 enh17917

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 10930247 rs560244223 TGGCAGTCAGCCACCTAGGTCAATAAGCACA T 5439440

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 10928105 10928126 - hsa-miR-199a-3p MIMAT0000232_1 10928332 0.761443 0.0 1913 820