EnhancerDB
  1. Home
  2. TFBS
  3. TLX1[chr19:10930246-10930260]
Chromosome characteristics of TLX1[chr19:10930246-10930260]
Back to top
Enhancers possibly regulated by TLX1[chr19:10930246-10930260]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 10918125 10930655 enh17917
Bone Marrow (K562) Astrocyte Bone (Osteoblast) Placenta Uterus Blood (T-cell) Stomach
SNP sites on TLX1[chr19:10930246-10930260]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 10930247 rs560244223 TGGCAGTCAGCCACCTAGGTCAATAAGCACA T 5439440
Genes possibly regulated by TLX1[chr19:10930246-10930260]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TLX1[chr19:10930246-10930260]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 10928105 10928126 - hsa-miR-199a-3p MIMAT0000232_1 10928332 0.761443 0.0 1914 820
Expression level of miRNAs
Back to top