Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 14325959 14334531 enh86303

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 14326881 rs563798743 A ATAT 5454223
chr19 14326881 rs58978016 A ATAT 5454224
chr19 14326883 rs531833852 A G 5454225
chr19 14326883 rs573582541 A ATTATATAATGTATAATATATAATG 5454226

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results