EnhancerDB
  1. Home
  2. TFBS
  3. HLF[chr14:52834199-52834211]
Chromosome characteristics of HLF[chr14:52834199-52834211]
Back to top
Enhancers possibly regulated by HLF[chr14:52834199-52834211]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 52825325 52839617 enh30880
Prostate (PC-3) Epithelial (MCF-7) Prostate (RWPE1) Astrocyte Lung Stomach Lung (PC-9) Muscle (Myoblast) Uterus Heart
SNP sites on HLF[chr14:52834199-52834211]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 52834199 rs554398283 TGATTGTGTAAGTACACGTAATAAA T 3542474
Genes possibly regulated by HLF[chr14:52834199-52834211]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by HLF[chr14:52834199-52834211]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results