Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 53475537 53486815 enh15620

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 53475925 rs534548893 CCTGCTCACCTGTGCCTGAA C 3545228

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results