Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 64322285 64339462 enh15674

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 64328236 rs374151286 CTGTAGCATATGCCTGTAATCCCAGCATTTT C 3602926

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results