EnhancerDB
  1. Home
  2. TFBS
  3. FOXB1[chr14:65137834-65137845]
Chromosome characteristics of FOXB1[chr14:65137834-65137845]
Back to top
Enhancers possibly regulated by FOXB1[chr14:65137834-65137845]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 65136345 65144215 enh15682
Cervix (HeLa-S3) Ovary Prostate (RWPE1) Esophagus Placenta Lung (PC-9) Uterus Blood (T-cell) Stomach
SNP sites on FOXB1[chr14:65137834-65137845]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 65137838 rs67572168 GTATATATATATATATATATATATATATATA G 3606167
chr14 65137838 rs71123870 GTATATATATATATATATATATATATATATA G 3606168
chr14 65137840 rs549364641 A G 3606169
Genes possibly regulated by FOXB1[chr14:65137834-65137845]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOXB1[chr14:65137834-65137845]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results