Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 65454645 65470815 enh3283

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 65457893 rs554375926 ATGGCATGGTGTCATTGAACCAT A 3608250

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results