Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 77179945 77198666 enh44046

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 77183035 rs35995285 GTTTCCTTCTATTCGTAAATATA G 3673795
chr14 77183035 rs373254514 GTTTCCTTCTATTCGTAAATATA G 3673796

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results