| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr14 | 89699485 | 89721855 | enh47781 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr14 | 89702193 | rs11271132 | T | TAGAGCCTGCAGATGGGATGCAGGCCTGCTGATGTCTTG | 3716046 | |
| chr14 | 89702193 | rs11273733 | T | TAGAGCCTGCAGATGGGATGCAGGCCTGCTGATGTCTTG | 3716047 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|