Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr14 | 89998285 | 90019435 | enh31108 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr14 | 90000074 | rs74493121 | A | G | 3719191 | |
chr14 | 90000077 | rs530268107 | GTACTGACTAAAAGCCATGTTTCCTCTTCCTTATGTTACAGC | G | 3719192 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|