Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 92995651 rs55703805 G C 3736169
chr14 92995656 rs572863608 GATCTCGGCTCACTGCAACCTCCACCTCCCC G 3736170

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results